Last night was Perseids night--we had our lawn chairs out, the full moon's light blocked by the garage at our backs. The mosquitoes, our state bird, were scarce enough that we had not slathered on whatever state-of-the-art organic compounds we use to ward off 6-legged critters these days.

Joe Westerberg, Joshua Tree National Park, California, Aug. 11, 2007

We saw a bat, a welcome sight. Then two. Now a third.

We held still, lying on our chairs, watching the bats chase bugs and each other, a spectacular aerial show against the deep gray-violet of the late dusk sky. And we realized that, really, the mosquitoes were remarkably scant.

A bat swooped up from the ground by our feet, no doubt, munching away. We watched the acrobats flip from their invisible trapezes a few more moments, then one swooped inches from our heads.

Now we know that bats tangling in your hair is an old wives' tale, but the few mosquitoes buzzing about our heads was tempting enough to the bats to show off their aerial skill a tad too close, and as much as we appreciated their predation, we scurried back inside.

Though we missed the main event, the Perseids changed our world in subtle ways:

• We spent the whole afternoon outside, as well as a good chunk of dusk. The dust of Perseid micro-meteorites fell on our hair. (Heck, you can catch micro-meteorites at home--really!)

• A few of my red blood cells gulped by a mosquito (or two) ended up in the belly of a bat, now broken down into tiny pieces. Some of it will become part of that bat, some released as carbon dioxide in the bat's breath, possibly captured by the Brussels sprouts nearby, which I will eat after November's first frost.

Communion.

The meteor photo was taken by Joe Westerberg, lifted from Spaceweather.com, used with permission.

READ MORE - Bats!

The sun may be dying, but its energy rests in the bonds around us, enough to keep most of us alive until the sun returns.

We are almost a week past Samhain. The bonfires have been lit, the dead done wandering. In the olden days, each clan took flame home from a shared bonfire to carry them through the winter. Animals were slaughtered for the coming winter.

Time to hunker down.

Here near the coast, the air tempered by the warmth of the sea, we get to stretch summer a few more days.

Today we harvested tomatoes and basil from the garden, and clams from the mud. The water is still warm enough for me to walk through the ripples, looking for keyholes that betray the quahogs below.

Tomorrow we may cull the kale and the Brussels sprouts. I may nibble on the few leathery beans hanging from the near dead vines--a reminder of what's past, and hope for the future.

Tomorrow I will gather dead flowers, harvesting seeds.

I will bring some of the seeds to class. A student has asked for a clam shell, one from a creature I have eaten.

Seed by seed, I hope to show my kids what lies outside the windows.

Photos ours, taken today.

READ MORE - November harvest

This is a long one, a rambling one, and very possibly a short-lived one. I'm reclaiming turf no one wants anyway.

Shark jumping, anyone?

Well, the Facebook post got over 1,200 hits, but when all is said and done, I changed no one's mind, and it's not a post I'd want to read 3 months after I stroke, bored to death in my wheel chair, wiling away the few hours I have left.

My Dad, a royal pain in the ass in so many ways, enjoyed life. He had a lot of strokes, enough that he volunteered to take a moth-balled A-4 Skyhawk and plant it anywhere in Iraq (with him still strappedin the cockpit) the POTUS ordered. He spent one of his precious last few days careening down a Cape May avenue in a motorized wheel chair, right smack dab in the middle of the double yellow line, laughing--at least I think it was laughing, hard to tell with all the paralysis.

My sister's wake was so joyous some folks crashed it thinking it was a wedding reception.

My Mom's last act of consciousness was a laugh.

We're an odd bunch.

***

A couple of hours ago I was thigh-deep in a warm, dark Delaware Bay, scurrying up trouble. Comb jellies glow when disturbed, an eerie electric blue as evanescent as phosphenes. Close your right eye, and push on it--see the light? That's a phosphene. Ain't English grand?

I was tromping through the water, whooping like a Confederate on Little Round Top. I'm not sure the jellies enjoyed it half as much as I did, no way to tell. Most of the ones I lit up tonight are going to be beached by Earl in the next few hours. It's kind of neat that I know these things, but even neater realizing that the jellies know things I cannot possibly ever understand.

Why was I on the beach? Hunting ghost crabs. I have a dream--some day I will lead children on ghost crab expeditions, freezing the critters with my flash light, sharing ghost crab tales as the kids marvel at the crabs..

I held my glasses out towards one of the crabs--it pounced on the ear piece,pulled it towards its mouth, then rejected it once it had a taste. This, of course, is of no interest to the reader. But it is of interest to me.

I knew the jellies might glow tonight because I wrote about them last year. Life's funny that way--we are all dependent on cycles, cycles dependent on the sunlight hitting the Earth. If the jellies were here last year at the end of summer, it's reasonable to expect them again now.

They did not disappoint

***

Everything alive today has been evolving for over 4 billion years. "Evolution" is a misnomer, not a word originally used by Darwin. He called it "descent with modification." Even the seemingly simplest organisms are blessed with gifts beyond our imagination.

***

A hurricane is looming just off-shore. Earl. Oh, it's just a Cat 2.

I like motorcycles. I used to lgo fast on motorcycles. I like going Category 2 fast--96 mph or better.

If you've ever ridden a bike at those speeds, you know that the wind becomes personified. It's real. It can hurt.

Now imagine trying to carry an oak tree through that wind.

I pray that it misses. A pox on those who wish otherwise.

***

I just cursed, and cursing works. Humans have selective memories. If one of my readers decides to root for Earl despite knowing that I may be harmed by it, then breaks his big toe in the next 3 months, he may well attribute the broken toe to my curse.

Or cancer. Or death of a loved one. Or any other event that is so terrible that we pretend its probability is near zero (despite the evidence that none of us get out of here alive).

Tonight I saw flashes of light emanating from the shallows of a muddy bay--I don't see this often. If Earl changes his mind (see, anthropomorphizing) tomorrow and destroys my home, I will blame myself for messing with jellies. I cannot help myself.

We find reasons for everything. We are evolutionarily wired to do so.

***

One reason Facebook resonates so is because of our need to belong. We used to belong to nature. In the 20th century we separated ourselves enough to find solace in clans without nature. Now we no longer need the clans.

We just need electrons.

Here I am beaming a series of electrons into your eyes. I'd rather have you here, sharing grits and grog.

When it gets down to it, I don't give a rat's butt about Facebook or Twitter. I care about the very few who get down this far on a post. /me waves to Leslie and John and Jessica and Sean .

A life dependent primarily on electrons is not a well-lived life. It may be lucrative. It may be exciting. But it's not a life.

I'd rather live the life dependent on photons, on the sun, on the phosphorescent critters less than a mile from here busy eating, and flashing, and reproducing, and God only knows what else.

Facebook cannot do that.
The Delaware Bay can.

READ MORE - This one's for me (and Leslie)

Is part of a public education reminding a child of her mortality?
And if so, would the task fall upon the biology teacher?

It's not a trivial matter. For all the posturing by folks at the national level about our record college enrollment rates, almost a third of graduating high school senior do not go. Many of those that do go are going to juice up their resumes more than their minds.

Would teaching mortality produce a more thoughtful citizenry?

***

All of this, whatever this this is, cannot last for any individual. The oldest known bacteria survived 250 million years, the oldest plant a mere 43,000 years. We tend to think of ourselves as special, a gift (or curse) of our consciousness.

The oldest animal? Maybe the clam--a quahog made it for 405 years. Alas, it was killed by the same scientists who marked its age.

Oldest conscious animal?

A 211 year old bowhead whale leads the list, roaming this Earth since John Adams was President, finally felled by an Inuit.

And good westerners that we are, we oooh and awwww at the record, imagining a life triple life span we have, again forgetting that we truly only live in moments.

How many Saturdays do you have left in a lifetime?


Would folks behave differently if they accepted mortality, accepted limits? Would we be braver? Would we spend hours inside manipulating artificial universes? Would we accept the culture we have?

***

We are all, in a sense, immortal, or at least as immortal as life on Earth. We all share ancestors. We all come from single celled organisms that continues the spark of life for billions of years, long enough for consciousness to develop.

Or maybe consciousness has been around much longer than we know. Bacteria talk to each other.




Dying, I suspect, is a big deal. It doesn't require a whole lot of practice, and just about every one of us will manage to accomplish it whether or not we have graduate degrees, but still, for each of us, it's the end of a universe (at least among the empiricists).

To be fair, I'm a bit warped. I grew up Oirish Catholic, I practiced medicine in the inner city when poor kids were doing their best to die from AIDS before the middle class even heard of it, and I've lost enough people to accept that maybe, just maybe, this death thing is permanent.

***

We relegate death to religion, and otherwise make it taboo. But we all face it.

Biology is literally the study of life--and life is defined by death, the ultimate limit for those of us who pretend to be conscious. A culture that recognizes limits has a chance to be sustainable.

A chance.

Just a chance. Which is more than we have now.....

The skull is from wikipedia, credited to Bernard Bill5
I've watched a lot of people die, most of them young--you will, too.

Ain't Bonnie Bassler wonderful?

READ MORE - Death in a classroom

In July, 1928, sliced bread debuted at the Chillicothe Baking Company in Missouri. The town now promotes itself as "The Home of Sliced Bread."

Chris Lehmann is the principal of the Science Leadership Academy, "a partnership high school between the School District of Philadelphia and The Franklin Institute. He recently spent 4 days at the Constructing Knowledge Conference (CMK), where he had the "chance to listen to, talk to, break bread with people like Deborah Meier, Alfie Kohn, Marvin Minsky and James Loewen,...."

"Break bread...."

Breaking bread has, for many, religious overtones. It's not a phrase you hear much anymore, and when you do, it's rarely literal.

At most conferences we share meals on our own sanitized plates using steam cleaned steel utensils to eat food made by strangers who often speak a different tongue.

Before Otto Rohwedder's bread-slicing machine became ubiquitous, we had whole loaves in our homes. We literally broke bread at mealtimes.

I think we were closer together when we did, because we did.

***

I occasionally make bread. I grind the wheat (a workout), then mix the flour, yeast, butter, water, and honey. I knead (another workout), let the dough rise, punch it down, let it rise again.

It's good, it's healthy, it's whole. I share the first piece with Leslie just about every time. We break bread together.

When we have close friends over, we may leave a whole bread loaf on the table, to be broken by our hands. Sometimes, sadly, the loaf stays unbroken.




One year we grew wheat in class--we had dozens of stalks on the windowsills. 2 or 3 times a week I would remind the students where the wheat stalk "stuff" came from: water and the carbon dioxide from our exhaled breaths.

The emerging wheat berries amazed the children, as it still amazes me. Kids in these parts rarely see mature grass. They saw the wheat as just a giant grass plant until the berries appeared, just like the same berries they planted.

At the end of the year, we got a handful of wheat berries and I ground them up with others, made the bread at home, and after a brief chat reminding the class where the bread came from, we broke bread.

Some of the class could not stomach the idea of trying a piece--I'm not eating anyone's stinky breath! Those who tried it mostly enjoyed it, especially a few who grew up on real bread before they came to the States.

***

What does any of this have to do with Chris Lehmann?

He writes about the frustration of building a robot at the CMK conference last week. His team (barely) succeeded, and he writes about the value of the process, about the value of gumption when things we try do not work well.

I've always wanted to make bread from scratch in class. Truly scratch. Grind the wheat berries. Churn the butter. All kinds of science would be involved.

I could never figure out how to do it, and am still not clear, but I'm going to try it anyway. I'm going to present the problem to the class, and we're going to solve it, or not, but learn in the process.

If we come up short, I will still end the year with a home-made loaf of bread, to break together in class to honor of our time together.

The poster is from the town of Chillicothe--you can order the poster here.

The woman baking bread and the wheat photos are from the National Archives.

READ MORE - Breaking bread

Beautiful July morning--I picked some purple beans with hues so deep and warm I wandered back to childhood. My fingers slipped through the vines knew what to do. There is unspeakable pleasure when we do what we are designed to do.

The first tomatoes are ripe now--tumescent with life. Four months ago they were tiny tufts of seeds I tucked into peat moss. My fingers knew what to do.


On mornings like this, one should avoid finiteness. The world holds wonderful and infinite complexity.

Alas, I'm an idiot, and logged into the internet.

***

I've given up Twitter before, and may give it up a few dozen times before I get it right. I follow teachie/techie type folks, and learn a lot. Today, perhaps, I learned my most important lesson. This was not it:

To folks who scream they don’t want private lives online:
Maybe you should just try to be a better person.

I am pretty much the same online as off. My Twitter account is "M_K_Doyle," not exactly a pseudonym. I stimulate annoy folks pretty much wherever my words take me. And I scream a lot. About just that....

I immediately let all 7 folks who follow me that I found that tweet scary. I tracked it down to Bud the Teacher, a marvelous edublogger. He clarifies his position a tad, but he's still scary.

And I think my public persona,
person I am at work and in the world,
be it the store, or church, or at the park or anywhere else, should be the same public persona online.

Bud Hunt, "On modeling," Bud the Teacher

Here’s the problem, and where modeling matters. We have multiple levels of intimacy/behavior in different settings.

What I say to a colleague in an elevator may be different than what I say to her in a pew, both public spaces by Hunt's example. The database searching capabilities have smashed our online personae into an extremely public figure–one with a megaphone screaming at anyone who cares to listen.

Part of becoming an adult is learning situational awareness. Lumping our online persona into some common public space sounds great, but there is no single layer of “public” in our real lives. (It’s like “global awareness,” another impossible task that sounds so cool.)

***

Today I saw this: "10 Reasons to Stop Apologizing for Your Online Life" on the Harvard Business Review blog, by Alexandra Samuel, a social media expert:

In our online lives we shake off the limitations of our physical selves, perhaps even our names and consciences, too. What remains are the fundamentals: human beings, human conversations, human communities. To say that "reality" includes only offline beings, offline conversations and offline communities is to say that face-to-face matters more than human-to-human.

I keep hoping to see "America's finest news source, The Onion" at the bottom, maybe the Harvard Lampoon.

My conscience, my name, my physical self is all human. The slight resistance feel as I pull a ripe tomato off the vine, its sensuousness as it rests alive in my palm, is part of who I am.

Face to face evoke all kinds of humanness, not all visual. My neighbor's aromas just beneath our consciousness, his growly gut, the preliminary hug or handshake--all involve a complexity and richness online cannot capture.

There is more complexity in a spoonful of the soil around my tomato plant that can be found on the whole of internet. We kid ourselves when we float on the web, amusing ourselves like bored kids throwing rocks at windows, passing time until we die.

Because we all die. Even if our web personae live on and on....

READ MORE - Down the rabbit hole....

Two summertime stories, both true, both observed this week:

Leslie, Kevin and I were kayaking in the Delaware Bay near the ferry jetty when we saw it--a mature bald eagle just over the lip of the shore. We've seen plenty of ospreys here, but never a bald eagle. We have one resident osprey that hunts around our little patch of paradise.

A moment later, we saw our osprey, laden with a live fish in its talons. The eagle saw it, too.

For several minutes we were treated to a spectacular aerial show--the osprey was more agile, even with the fish, but the bald eagle was faster. The two spiraled up and up and up to the edge of the clouds, then dove down again.

I got excited as I imagined writing to Nature about the thievery of a bald eagle. Alas, a Google search saved me a stamp and some embarrassment. Turns out this is what bald eagles do. Even Ben Franklin knew this:

For my own part I wish the Bald Eagle had not been chosen the Representative of our Country. He is a Bird of bad moral Character. He does not get his Living honestly. You may have seen him perched on some dead Tree near the River, where, too lazy to fish for himself, he watches the Labour of the Fishing Hawk; and when that diligent Bird has at length taken a Fish, and is bearing it to his Nest for the Support of his Mate and young Ones, the Bald Eagle pursues him and takes it from him.

Another website, Stephen Caswell's travelogue, captured the intensity of the chase in both words and photos.

Second story:

Dragonflies, like osprey, are fine hunters with remarkable vision and adept flight. Some tiny insects hatched near our home, visible as flitting glowing tufts in the setting sunlight.

Two large dragonflies, each almost as big as my hands, swooped in. If you watch them carefully, you can see them catch their prey. One lit on a day lily stalk next to me. It cocked its head my way for a couple of seconds, understood I was not a threat, then went back to watching his meal.

Neither story is remarkable in itself, but both mesmerizing to watch unfold.

I suppose I could show a video in class, or make an interactive game where the child pretends she is a dragonfly, or have the kids plot food webs, or any number of things that pass for interactive and authentic education today.

But what that child really needed was a hot July afternoon, a free afternoon, and a stoop. A glass of lemonade wouldn't hurt.

The world is more wonderful than any of us can imagine--it gives back whatever you put into it, and more. While pretending to polish my curriculum this morning, I wandered over to the #LBC10 on Twitter, yet another education/technology MashCon.

Like the musicians of Bremen, everyone is in love with the sound of his own voice, everyone tweeting tweeting tweeting, hoping to be validated with the retweet by another, constructing a busy world run by and full of humans.

No dragonflies. No eagles. No time to reflect.

READ MORE - And the living is easy....

GCAGTAATGACGCTGGGCGAAATACGTCCGAAGCAACTGTTGGTG

If you string the above sequence of DNA bases in a crab, you get a piece of crabbiness.

AGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTAAGATTACAC

If you string the above sequence, you get a piece of humanness. Nothing startling to a high school sophomore.

If, however, you put the piece of crabbiness into the humanness, though, the human cells will make it exactly the same way the crab cells will. And vice versa. That startles sophomores.

***

Copies of human genes put into the same bacteria that live in your gut, E. coli, will instruct the bacteria to make human genes.

Humulin®, sold as human insulin, isn't so human after all--it's made from poop bugs sitting in large vats, I imagine, then separated from its producers. Novolin®, another version of human insulin, is made using yeast cells.

I did my own bit of yeast farming yesterday--I scraped out about 10 pounds of honey (it had crystallized), crushed about 8 pounds of frozen peaches left over from the summer, mixed them with water and yeast, and now I've got a 6 gallon yeast party going on in the kitchen.

Peaches and honey feed the yeast, and this summer, as the sun sets at a more reasonable hour, Leslie and I will be sitting outside by the basil, sharing peach melomel, the once exuberant yeast dormant on the bottom of the bottle.

The melomel won't cure anything, but it heals a lot. I'm using a process humans have used for thousands of years. Blue crabs make insulin-like proteins, and have, for thousands of years. Life in its myriad organisms bopped along using the same genetic code for over 3 billion years before one strain, H. sapiens, figured this out.

I'm betting most of the folks who designed Humulin® for a living do not grow wheat, or brew beer, or spin cloth from fibers combed from sheep. They're bright, reasonably well paid, and no doubt outstanding citizens in their spheres.

I'm also betting most do not know how to grow wheat, or brew beer, or spin cloth from fibers combed from sheep.

We've mastered the mechanics of designing life the same few generations we lost our taboos, our gods, our guides to living in this happy mess of life we cannot comprehend.

Hubris has a history.
We're going to learn the same lessons again.

Photo by Leslie, taken yesterday, along the Delaware Bay.

READ MORE - Grasping life

Just took this picture a few hours ago. It's a bit chilly at the edge of the Delaware Bay, and the breeze was kicking up to 25 knots, but Leslie and I wandered outside anyway, as we pretty much do whenever we can.

Our imaginations are too small for this world.





And you're going to enjoy it, even if we have to legislate it.
Where's Walt Kelly when we need him? Congress puts The Onion to shame.

READ MORE - January sunset

The annuals are flowering like there's no tomorrow, and for them, that's reason enough. I gathered up 8 or 10 small cherry tomatoes this morning. A small eggplant hangs from a plant still daring to flower.

The basil is still flowering. converting the sun's energy into nectar to attract the bees, which are still buzzing, who will use the sugar to produce honey to keep them alive for the few months around here when the sunlight weakens too much to support all the life of summer.

From The Lancet, (Britain's version of our New England Journal of Medicine):

If the pace of increase in life expectancy in developed countries over the past two centuries continues through the 21st century, most babies born since 2000 in France, Germany, Italy, the UK, the USA, Canada, Japan, and other countries with long life expectancies will celebrate their 100th birthdays.

Does that make you feel better? More relaxed?
Did you do anything today that makes living to 100 a bigger deal than living to, say, 50 years old?

***

I run a class website, but I keep it separate from here. The class site is for students and their parents, this one is for me and a handful of folks who share similar conversations. The last thing I need is a chat with an administrator who wonders why I implied that humans are doomed, that life is awesome whether (or the more likely not) humans choose to continue to be part of it, and that current economic practices have (in a biological sense, anyway) predictable consequences, consequences best not shared with children in a public setting.

I have a bad habit in the classroom. Anytime a students asks me "if I do such and such will I die?" my answer is always the same.

You will die.
But not today.
And not because of "such and such."

(Unless it is one of my wackadoodles wondering if it's OK to mix bleach and ammonia just to see what happens--do not do this.)

***

The altar of the horseshoe crab
Cape May, September 28, built and abandoned by an anonymous child

I find solace in that eggplant flowering as the days darken. I do what I can do, but I am not wrapped up in grief over a culture that cannot be sustained more than a few more generations if current practices continue.

I am not going to hammer the kids with images of what we have destroyed--I want them to see what we have.

If a child starts to recognize the beauty and structure of the flow of life, starts to recognize the mystery of what we do not (and cannot) know as truly a mystery that cannot be solved by a bigger shot of technology, starts to truly see how everything is held together by everything else, she will smile before she despairs.

And she just might figure out a few worthwhile things to do with the extra decade or two she gets in the bargain.

The child who built her altar above has a clue. I hope she still does by the time she finishes high school.

READ MORE - The altar of the horseshoe crab

I've been busy. Too busy.

Too busy to clam, to write, to stargaze, to play my guitar, to get drunk, to chase ghost crabs on midnight beaches, to watch the monarch butterfly migration, to catch sea bass, to carve wood, to watch the ferry come and go, to brew peach melomel, to be human.

Last night Leslie and I stargazed on the edge of the Delaware Bay, chased ghost crabs under the starlight, and today we raked up some clams from Richardson Sound. I will play my guitar tonight for her after an ale (or two), and tomorrow I hope to sit on the jetty and watch the butterflies flutter by. Next week I'm brewing peach melomel, come hell or high water, and I am "wasting" my time writing now.

***

My hands smell like low tide at the moment--I played, today, and rejoined the universe. Women and cilantro and bay mud all smell like life, and that's no accident. I forget sometimes. If I ever forget permanently, I may as well be dead.

Clamming is serious business--it costs lives. Not just the lives of the clams and, occasionally humans. I rake up bloodworms, tiny blue claws, whelks, and all kinds of critters I cannot see.

Clamming is serious business--it feeds lives, As I stir up the muck, shrimp and kellies and whelks congregate around me, nibbling on the manna, and occasionally nibbling on me (apparently psoriasis is tasty).

Right now 15 clams sit in the fridge--I raked up a few more than that, but Leslie and I decided that 15 was enough, so I put a few back. I scooped up a few small holes in the sound, and placed the clams in my artificial beds. No doubt I killed a few thousand critters to save the few extra clams I dug up. Still, there's something to be said for knowing when enough is enough. (15 clams for two people may be too much.)

***

I teach, or try to, anyway. I teach about excited electrons, Latinized naming systems, and entropy. It's all very exciting for me, but out of context, I'd bet it's stultifying. If you're 15 years old in our culture, a culture predicated on lies and salesmanship, what I teach is out of context.

A couple of hours ago I was sitting in a kayak, surrounded by water and herons and sea weed and egrets and cormorants and, of course, clams. Context.

If you kill but do not consciously slaughter, you are missing something. It is very hard to live without killing, unless you are a green plant. If you are not a green plant, you have an odd sort of agreement with the universe.

***

I love Walt Kelly's work, and had I known him personally, I'd have loved him, too.



This is the 2nd time the pogo strip used the phrase "Don't take life too serious...it ain't nohow permanent." Walt was alive the first time. He's still alive in my head.

We pretend we're as immortal as the corporations influencing our curriculum, but, of course, we are not. IBM will exist long after my children celebrate my life at a good ol' fashioned Oirish wake.

If I teach nothing else this year, I hope I teach this much.

You are alive, part of a mystery that you cannot comprehend. You will die, also a part of a mystery you cannot comprehend. Enjoy the ride.

(Alas, it's not in the New Jersey Core Curriculum Content Science Standards. I'm teaching it anyway.)

Addendum: turns out 15 clams was just right.

READ MORE - Walt Kelly is dead. Long live Walt Kelly.

Our neighbor's father died last night after a brief but ravaging illness.

The usual laughter rising over the fence has been missing the last few weeks, and I suspect it will be some time before it returns.

An earlier thunderstorm cleaned the air, as they do in Jersey, and the azure dusk sky marked the last few hours of June. My tiny pond was already wrapped in gray shadows, everything but the sky bled of color except for the occasional cool fire of a lightning bug.

The end of June marks the start of the dying of the light, punctuated by the mourning next door.

I turned to go back inside, then turned back again. I did not want June to end.

On top of the stockade fence separating our yards is a small platform I built a couple of years ago, a place for my potted plants to grab a little more light. (A maple tree keeps growing, and my garden now falls under its shade.)

A forgotten prickly pear sits in a cracked pot--I've had it for years, given to me by a friend I've not chatted with in a long while. After winter the plant looks dead, shriveled, and every year it surprises me.

I gazed up over the fence to catch the last blue light of the fading sky, and my eye caught a hint of yellow on top of the fence.

The prickly pear had flowered, first time ever.

I can hypothesize about the why. I can postulate that the extra light the cactus now gets triggered some photoperiodic phenomenom. I could look up some articles on the internet to sate my curiosity.

But I won't.

I know this much--an good man who has led a good life dies, and before the next sunset, a cactus that felt the vibrations of the man's voice bloomed.

I also know that the flesh of this cactus holds some of the carbon that once flowed in this man's blood--parts of the flower came from inside his mitochondria, in the deepest cells in his body when he still breathed.Literally.

I have my own private beliefs concerning this particular cactus blooming this particular hour.

It's easy to watch the symphony of life outside, as though we're not part of all this, as though we're special, immortal.

We are not.

I need to call the person who broke off the cactus pad years ago, plopped it on a pot, and assured me it would grow. June is almost gone. It's later than I realize.

Prickly pear photo by the EPA, 1972, in the public domain via the National Archives.

READ MORE - Communion