GCAGTAATGACGCTGGGCGAAATACGTCCGAAGCAACTGTTGGTG

If you string the above sequence of DNA bases in a crab, you get a piece of crabbiness.

AGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTAAGATTACAC

If you string the above sequence, you get a piece of humanness. Nothing startling to a high school sophomore.

If, however, you put the piece of crabbiness into the humanness, though, the human cells will make it exactly the same way the crab cells will. And vice versa. That startles sophomores.

***

Copies of human genes put into the same bacteria that live in your gut, E. coli, will instruct the bacteria to make human genes.

Humulin®, sold as human insulin, isn't so human after all--it's made from poop bugs sitting in large vats, I imagine, then separated from its producers. Novolin®, another version of human insulin, is made using yeast cells.

I did my own bit of yeast farming yesterday--I scraped out about 10 pounds of honey (it had crystallized), crushed about 8 pounds of frozen peaches left over from the summer, mixed them with water and yeast, and now I've got a 6 gallon yeast party going on in the kitchen.

Peaches and honey feed the yeast, and this summer, as the sun sets at a more reasonable hour, Leslie and I will be sitting outside by the basil, sharing peach melomel, the once exuberant yeast dormant on the bottom of the bottle.

The melomel won't cure anything, but it heals a lot. I'm using a process humans have used for thousands of years. Blue crabs make insulin-like proteins, and have, for thousands of years. Life in its myriad organisms bopped along using the same genetic code for over 3 billion years before one strain, H. sapiens, figured this out.

I'm betting most of the folks who designed Humulin® for a living do not grow wheat, or brew beer, or spin cloth from fibers combed from sheep. They're bright, reasonably well paid, and no doubt outstanding citizens in their spheres.

I'm also betting most do not know how to grow wheat, or brew beer, or spin cloth from fibers combed from sheep.

We've mastered the mechanics of designing life the same few generations we lost our taboos, our gods, our guides to living in this happy mess of life we cannot comprehend.

Hubris has a history.
We're going to learn the same lessons again.

Photo by Leslie, taken yesterday, along the Delaware Bay.